source: vendor/perl/5.8.8/pod/perlretut.pod@ 3280

Last change on this file since 3280 was 3181, checked in by bird, 19 years ago

perl 5.8.8

File size: 98.5 KB
RevLine 
[3181]1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
44introduces the latest cutting edge innovations in 5.6.0.
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
62What is this perl statement all about? C<"Hello World"> is a simple
63double quoted string. C<World> is the regular expression and the
64C<//> enclosing C</World/> tells perl to search a string for a match.
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
79be reversed by using C<!~> operator:
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
118same thing. When, e.g., C<""> is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in a regexp
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
131S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
140If a regexp matches in more than one place in the string, perl will
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
148is' in a match. Some characters, called B<metacharacters>, are reserved
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
161 "/usr/bin/perl" =~ /\/usr\/bin\/perl/; # matches
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
168 "/usr/bin/perl" =~ m!/usr/bin/perl!; # easier to read
169
170The backslash character C<'\'> is a metacharacter itself and needs to
171be backslashed:
172
173 'C:\WIN32' =~ /C:\\WIN/; # matches
174
175In addition to the metacharacters, there are some ASCII characters
176which don't have printable character equivalents and are instead
177represented by B<escape sequences>. Common examples are C<\t> for a
178tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
179bell. If your string is better thought of as a sequence of arbitrary
180bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
181sequence, e.g., C<\x1B> may be a more natural representation for your
182bytes. Here are some examples of escapes:
183
184 "1000\t2000" =~ m(0\t2) # matches
185 "1000\n2000" =~ /0\n20/ # matches
186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
187 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
188
189If you've been around Perl a while, all this talk of escape sequences
190may seem familiar. Similar escape sequences are used in double-quoted
191strings and in fact the regexps in Perl are mostly treated as
192double-quoted strings. This means that variables can be used in
193regexps as well. Just like double-quoted strings, the values of the
194variables in the regexp will be substituted in before the regexp is
195evaluated for matching purposes. So we have:
196
197 $foo = 'house';
198 'housecat' =~ /$foo/; # matches
199 'cathouse' =~ /cat$foo/; # matches
200 'housecat' =~ /${foo}cat/; # matches
201
202So far, so good. With the knowledge above you can already perform
203searches with just about any literal string regexp you can dream up.
204Here is a I<very simple> emulation of the Unix grep program:
205
206 % cat > simple_grep
207 #!/usr/bin/perl
208 $regexp = shift;
209 while (<>) {
210 print if /$regexp/;
211 }
212 ^D
213
214 % chmod +x simple_grep
215
216 % simple_grep abba /usr/dict/words
217 Babbage
218 cabbage
219 cabbages
220 sabbath
221 Sabbathize
222 Sabbathizes
223 sabbatical
224 scabbard
225 scabbards
226
227This program is easy to understand. C<#!/usr/bin/perl> is the standard
228way to invoke a perl program from the shell.
229S<C<$regexp = shift;> > saves the first command line argument as the
230regexp to be used, leaving the rest of the command line arguments to
231be treated as files. S<C<< while (<>) >> > loops over all the lines in
232all the files. For each line, S<C<print if /$regexp/;> > prints the
233line if the regexp matches the line. In this line, both C<print> and
234C</$regexp/> use the default variable C<$_> implicitly.
235
236With all of the regexps above, if the regexp matched anywhere in the
237string, it was considered a match. Sometimes, however, we'd like to
238specify I<where> in the string the regexp should try to match. To do
239this, we would use the B<anchor> metacharacters C<^> and C<$>. The
240anchor C<^> means match at the beginning of the string and the anchor
241C<$> means match at the end of the string, or before a newline at the
242end of the string. Here is how they are used:
243
244 "housekeeper" =~ /keeper/; # matches
245 "housekeeper" =~ /^keeper/; # doesn't match
246 "housekeeper" =~ /keeper$/; # matches
247 "housekeeper\n" =~ /keeper$/; # matches
248
249The second regexp doesn't match because C<^> constrains C<keeper> to
250match only at the beginning of the string, but C<"housekeeper"> has
251keeper starting in the middle. The third regexp does match, since the
252C<$> constrains C<keeper> to match only at the end of the string.
253
254When both C<^> and C<$> are used at the same time, the regexp has to
255match both the beginning and the end of the string, i.e., the regexp
256matches the whole string. Consider
257
258 "keeper" =~ /^keep$/; # doesn't match
259 "keeper" =~ /^keeper$/; # matches
260 "" =~ /^$/; # ^$ matches an empty string
261
262The first regexp doesn't match because the string has more to it than
263C<keep>. Since the second regexp is exactly the string, it
264matches. Using both C<^> and C<$> in a regexp forces the complete
265string to match, so it gives you complete control over which strings
266match and which don't. Suppose you are looking for a fellow named
267bert, off in a string by himself:
268
269 "dogbert" =~ /bert/; # matches, but not what you want
270
271 "dilbert" =~ /^bert/; # doesn't match, but ..
272 "bertram" =~ /^bert/; # matches, so still not good enough
273
274 "bertram" =~ /^bert$/; # doesn't match, good
275 "dilbert" =~ /^bert$/; # doesn't match, good
276 "bert" =~ /^bert$/; # matches, perfect
277
278Of course, in the case of a literal string, one could just as easily
279use the string equivalence S<C<$string eq 'bert'> > and it would be
280more efficient. The C<^...$> regexp really becomes useful when we
281add in the more powerful regexp tools below.
282
283=head2 Using character classes
284
285Although one can already do quite a lot with the literal string
286regexps above, we've only scratched the surface of regular expression
287technology. In this and subsequent sections we will introduce regexp
288concepts (and associated metacharacter notations) that will allow a
289regexp to not just represent a single character sequence, but a I<whole
290class> of them.
291
292One such concept is that of a B<character class>. A character class
293allows a set of possible characters, rather than just a single
294character, to match at a particular point in a regexp. Character
295classes are denoted by brackets C<[...]>, with the set of characters
296to be possibly matched inside. Here are some examples:
297
298 /cat/; # matches 'cat'
299 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
300 /item[0123456789]/; # matches 'item0' or ... or 'item9'
301 "abc" =~ /[cab]/; # matches 'a'
302
303In the last statement, even though C<'c'> is the first character in
304the class, C<'a'> matches because the first character position in the
305string is the earliest point at which the regexp can match.
306
307 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
308 # 'yes', 'Yes', 'YES', etc.
309
310This regexp displays a common task: perform a case-insensitive
311match. Perl provides away of avoiding all those brackets by simply
312appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
313can be rewritten as C</yes/i;>. The C<'i'> stands for
314case-insensitive and is an example of a B<modifier> of the matching
315operation. We will meet other modifiers later in the tutorial.
316
317We saw in the section above that there were ordinary characters, which
318represented themselves, and special characters, which needed a
319backslash C<\> to represent themselves. The same is true in a
320character class, but the sets of ordinary and special characters
321inside a character class are different than those outside a character
322class. The special characters for a character class are C<-]\^$>. C<]>
323is special because it denotes the end of a character class. C<$> is
324special because it denotes a scalar variable. C<\> is special because
325it is used in escape sequences, just like above. Here is how the
326special characters C<]$\> are handled:
327
328 /[\]c]def/; # matches ']def' or 'cdef'
329 $x = 'bcr';
330 /[$x]at/; # matches 'bat', 'cat', or 'rat'
331 /[\$x]at/; # matches '$at' or 'xat'
332 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
333
334The last two are a little tricky. in C<[\$x]>, the backslash protects
335the dollar sign, so the character class has two members C<$> and C<x>.
336In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
337variable and substituted in double quote fashion.
338
339The special character C<'-'> acts as a range operator within character
340classes, so that a contiguous set of characters can be written as a
341range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
342become the svelte C<[0-9]> and C<[a-z]>. Some examples are
343
344 /item[0-9]/; # matches 'item0' or ... or 'item9'
345 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
346 # 'baa', 'xaa', 'yaa', or 'zaa'
347 /[0-9a-fA-F]/; # matches a hexadecimal digit
348 /[0-9a-zA-Z_]/; # matches a "word" character,
349 # like those in a perl variable name
350
351If C<'-'> is the first or last character in a character class, it is
352treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
353all equivalent.
354
355The special character C<^> in the first position of a character class
356denotes a B<negated character class>, which matches any character but
357those in the brackets. Both C<[...]> and C<[^...]> must match a
358character, or the match fails. Then
359
360 /[^a]at/; # doesn't match 'aat' or 'at', but matches
361 # all other 'bat', 'cat, '0at', '%at', etc.
362 /[^0-9]/; # matches a non-numeric character
363 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
364
365Now, even C<[0-9]> can be a bother the write multiple times, so in the
366interest of saving keystrokes and making regexps more readable, Perl
367has several abbreviations for common character classes:
368
369=over 4
370
371=item *
372
373\d is a digit and represents [0-9]
374
375=item *
376
377\s is a whitespace character and represents [\ \t\r\n\f]
378
379=item *
380
381\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
382
383=item *
384
385\D is a negated \d; it represents any character but a digit [^0-9]
386
387=item *
388
389\S is a negated \s; it represents any non-whitespace character [^\s]
390
391=item *
392
393\W is a negated \w; it represents any non-word character [^\w]
394
395=item *
396
397The period '.' matches any character but "\n"
398
399=back
400
401The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
402of character classes. Here are some in use:
403
404 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
405 /[\d\s]/; # matches any digit or whitespace character
406 /\w\W\w/; # matches a word char, followed by a
407 # non-word char, followed by a word char
408 /..rt/; # matches any two chars, followed by 'rt'
409 /end\./; # matches 'end.'
410 /end[.]/; # same thing, matches 'end.'
411
412Because a period is a metacharacter, it needs to be escaped to match
413as an ordinary period. Because, for example, C<\d> and C<\w> are sets
414of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
415fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
416C<[\W]>. Think DeMorgan's laws.
417
418An anchor useful in basic regexps is the S<B<word anchor> >
419C<\b>. This matches a boundary between a word character and a non-word
420character C<\w\W> or C<\W\w>:
421
422 $x = "Housecat catenates house and cat";
423 $x =~ /cat/; # matches cat in 'housecat'
424 $x =~ /\bcat/; # matches cat in 'catenates'
425 $x =~ /cat\b/; # matches cat in 'housecat'
426 $x =~ /\bcat\b/; # matches 'cat' at end of string
427
428Note in the last example, the end of the string is considered a word
429boundary.
430
431You might wonder why C<'.'> matches everything but C<"\n"> - why not
432every character? The reason is that often one is matching against
433lines and would like to ignore the newline characters. For instance,
434while the string C<"\n"> represents one line, we would like to think
435of as empty. Then
436
437 "" =~ /^$/; # matches
438 "\n" =~ /^$/; # matches, "\n" is ignored
439
440 "" =~ /./; # doesn't match; it needs a char
441 "" =~ /^.$/; # doesn't match; it needs a char
442 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
443 "a" =~ /^.$/; # matches
444 "a\n" =~ /^.$/; # matches, ignores the "\n"
445
446This behavior is convenient, because we usually want to ignore
447newlines when we count and match characters in a line. Sometimes,
448however, we want to keep track of newlines. We might even want C<^>
449and C<$> to anchor at the beginning and end of lines within the
450string, rather than just the beginning and end of the string. Perl
451allows us to choose between ignoring and paying attention to newlines
452by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
453single line and multi-line and they determine whether a string is to
454be treated as one continuous string, or as a set of lines. The two
455modifiers affect two aspects of how the regexp is interpreted: 1) how
456the C<'.'> character class is defined, and 2) where the anchors C<^>
457and C<$> are able to match. Here are the four possible combinations:
458
459=over 4
460
461=item *
462
463no modifiers (//): Default behavior. C<'.'> matches any character
464except C<"\n">. C<^> matches only at the beginning of the string and
465C<$> matches only at the end or before a newline at the end.
466
467=item *
468
469s modifier (//s): Treat string as a single long line. C<'.'> matches
470any character, even C<"\n">. C<^> matches only at the beginning of
471the string and C<$> matches only at the end or before a newline at the
472end.
473
474=item *
475
476m modifier (//m): Treat string as a set of multiple lines. C<'.'>
477matches any character except C<"\n">. C<^> and C<$> are able to match
478at the start or end of I<any> line within the string.
479
480=item *
481
482both s and m modifiers (//sm): Treat string as a single long line, but
483detect multiple lines. C<'.'> matches any character, even
484C<"\n">. C<^> and C<$>, however, are able to match at the start or end
485of I<any> line within the string.
486
487=back
488
489Here are examples of C<//s> and C<//m> in action:
490
491 $x = "There once was a girl\nWho programmed in Perl\n";
492
493 $x =~ /^Who/; # doesn't match, "Who" not at start of string
494 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
495 $x =~ /^Who/m; # matches, "Who" at start of second line
496 $x =~ /^Who/sm; # matches, "Who" at start of second line
497
498 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
499 $x =~ /girl.Who/s; # matches, "." matches "\n"
500 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
501 $x =~ /girl.Who/sm; # matches, "." matches "\n"
502
503Most of the time, the default behavior is what is want, but C<//s> and
504C<//m> are occasionally very useful. If C<//m> is being used, the start
505of the string can still be matched with C<\A> and the end of string
506can still be matched with the anchors C<\Z> (matches both the end and
507the newline before, like C<$>), and C<\z> (matches only the end):
508
509 $x =~ /^Who/m; # matches, "Who" at start of second line
510 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
511
512 $x =~ /girl$/m; # matches, "girl" at end of first line
513 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
514
515 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
516 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
517
518We now know how to create choices among classes of characters in a
519regexp. What about choices among words or character strings? Such
520choices are described in the next section.
521
522=head2 Matching this or that
523
524Sometimes we would like to our regexp to be able to match different
525possible words or character strings. This is accomplished by using
526the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
527form the regexp C<dog|cat>. As before, perl will try to match the
528regexp at the earliest possible point in the string. At each
529character position, perl will first try to match the first
530alternative, C<dog>. If C<dog> doesn't match, perl will then try the
531next alternative, C<cat>. If C<cat> doesn't match either, then the
532match fails and perl moves to the next position in the string. Some
533examples:
534
535 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
536 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
537
538Even though C<dog> is the first alternative in the second regexp,
539C<cat> is able to match earlier in the string.
540
541 "cats" =~ /c|ca|cat|cats/; # matches "c"
542 "cats" =~ /cats|cat|ca|c/; # matches "cats"
543
544Here, all the alternatives match at the first string position, so the
545first alternative is the one that matches. If some of the
546alternatives are truncations of the others, put the longest ones first
547to give them a chance to match.
548
549 "cab" =~ /a|b|c/ # matches "c"
550 # /a|b|c/ == /[abc]/
551
552The last example points out that character classes are like
553alternations of characters. At a given character position, the first
554alternative that allows the regexp match to succeed will be the one
555that matches.
556
557=head2 Grouping things and hierarchical matching
558
559Alternation allows a regexp to choose among alternatives, but by
560itself it unsatisfying. The reason is that each alternative is a whole
561regexp, but sometime we want alternatives for just part of a
562regexp. For instance, suppose we want to search for housecats or
563housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
564inefficient because we had to type C<house> twice. It would be nice to
565have parts of the regexp be constant, like C<house>, and some
566parts have alternatives, like C<cat|keeper>.
567
568The B<grouping> metacharacters C<()> solve this problem. Grouping
569allows parts of a regexp to be treated as a single unit. Parts of a
570regexp are grouped by enclosing them in parentheses. Thus we could solve
571the C<housecat|housekeeper> by forming the regexp as
572C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
573C<house> followed by either C<cat> or C<keeper>. Some more examples
574are
575
576 /(a|b)b/; # matches 'ab' or 'bb'
577 /(ac|b)b/; # matches 'acb' or 'bb'
578 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
579 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
580
581 /house(cat|)/; # matches either 'housecat' or 'house'
582 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
583 # 'house'. Note groups can be nested.
584
585 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
586 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
587 # because '20\d\d' can't match
588
589Alternations behave the same way in groups as out of them: at a given
590string position, the leftmost alternative that allows the regexp to
591match is taken. So in the last example at the first string position,
592C<"20"> matches the second alternative, but there is nothing left over
593to match the next two digits C<\d\d>. So perl moves on to the next
594alternative, which is the null alternative and that works, since
595C<"20"> is two digits.
596
597The process of trying one alternative, seeing if it matches, and
598moving on to the next alternative if it doesn't, is called
599B<backtracking>. The term 'backtracking' comes from the idea that
600matching a regexp is like a walk in the woods. Successfully matching
601a regexp is like arriving at a destination. There are many possible
602trailheads, one for each string position, and each one is tried in
603order, left to right. From each trailhead there may be many paths,
604some of which get you there, and some which are dead ends. When you
605walk along a trail and hit a dead end, you have to backtrack along the
606trail to an earlier point to try another trail. If you hit your
607destination, you stop immediately and forget about trying all the
608other trails. You are persistent, and only if you have tried all the
609trails from all the trailheads and not arrived at your destination, do
610you declare failure. To be concrete, here is a step-by-step analysis
611of what perl does when it tries to match the regexp
612
613 "abcde" =~ /(abd|abc)(df|d|de)/;
614
615=over 4
616
617=item 0
618
619Start with the first letter in the string 'a'.
620
621=item 1
622
623Try the first alternative in the first group 'abd'.
624
625=item 2
626
627Match 'a' followed by 'b'. So far so good.
628
629=item 3
630
631'd' in the regexp doesn't match 'c' in the string - a dead
632end. So backtrack two characters and pick the second alternative in
633the first group 'abc'.
634
635=item 4
636
637Match 'a' followed by 'b' followed by 'c'. We are on a roll
638and have satisfied the first group. Set $1 to 'abc'.
639
640=item 5
641
642Move on to the second group and pick the first alternative
643'df'.
644
645=item 6
646
647Match the 'd'.
648
649=item 7
650
651'f' in the regexp doesn't match 'e' in the string, so a dead
652end. Backtrack one character and pick the second alternative in the
653second group 'd'.
654
655=item 8
656
657'd' matches. The second grouping is satisfied, so set $2 to
658'd'.
659
660=item 9
661
662We are at the end of the regexp, so we are done! We have
663matched 'abcd' out of the string "abcde".
664
665=back
666
667There are a couple of things to note about this analysis. First, the
668third alternative in the second group 'de' also allows a match, but we
669stopped before we got to it - at a given character position, leftmost
670wins. Second, we were able to get a match at the first character
671position of the string 'a'. If there were no matches at the first
672position, perl would move to the second character position 'b' and
673attempt the match all over again. Only when all possible paths at all
674possible character positions have been exhausted does perl give
675up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
676
677Even with all this work, regexp matching happens remarkably fast. To
678speed things up, during compilation stage, perl compiles the regexp
679into a compact sequence of opcodes that can often fit inside a
680processor cache. When the code is executed, these opcodes can then run
681at full throttle and search very quickly.
682
683=head2 Extracting matches
684
685The grouping metacharacters C<()> also serve another completely
686different function: they allow the extraction of the parts of a string
687that matched. This is very useful to find out what matched and for
688text processing in general. For each grouping, the part that matched
689inside goes into the special variables C<$1>, C<$2>, etc. They can be
690used just as ordinary variables:
691
692 # extract hours, minutes, seconds
693 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
694 $hours = $1;
695 $minutes = $2;
696 $seconds = $3;
697 }
698
699Now, we know that in scalar context,
700S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
701value. In list context, however, it returns the list of matched values
702C<($1,$2,$3)>. So we could write the code more compactly as
703
704 # extract hours, minutes, seconds
705 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
706
707If the groupings in a regexp are nested, C<$1> gets the group with the
708leftmost opening parenthesis, C<$2> the next opening parenthesis,
709etc. For example, here is a complex regexp and the matching variables
710indicated below it:
711
712 /(ab(cd|ef)((gi)|j))/;
713 1 2 34
714
715so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For
716convenience, perl sets C<$+> to the string held by the highest numbered
717C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the
718value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>,
719C<$2>, ... associated with the rightmost closing parenthesis used in the
720match).
721
722Closely associated with the matching variables C<$1>, C<$2>, ... are
723the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
724matching variables that can be used I<inside> a regexp. This is a
725really nice feature - what matches later in a regexp can depend on
726what matched earlier in the regexp. Suppose we wanted to look
727for doubled words in text, like 'the the'. The following regexp finds
728all 3-letter doubles with a space in between:
729
730 /(\w\w\w)\s\1/;
731
732The grouping assigns a value to \1, so that the same 3 letter sequence
733is used for both parts. Here are some words with repeated parts:
734
735 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
736 beriberi
737 booboo
738 coco
739 mama
740 murmur
741 papa
742
743The regexp has a single grouping which considers 4-letter
744combinations, then 3-letter combinations, etc. and uses C<\1> to look for
745a repeat. Although C<$1> and C<\1> represent the same thing, care should be
746taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
747and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
748so may lead to surprising and/or undefined results.
749
750In addition to what was matched, Perl 5.6.0 also provides the
751positions of what was matched with the C<@-> and C<@+>
752arrays. C<$-[0]> is the position of the start of the entire match and
753C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
754position of the start of the C<$n> match and C<$+[n]> is the position
755of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
756this code
757
758 $x = "Mmm...donut, thought Homer";
759 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
760 foreach $expr (1..$#-) {
761 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
762 }
763
764prints
765
766 Match 1: 'Mmm' at position (0,3)
767 Match 2: 'donut' at position (6,11)
768
769Even if there are no groupings in a regexp, it is still possible to
770find out what exactly matched in a string. If you use them, perl
771will set C<$`> to the part of the string before the match, will set C<$&>
772to the part of the string that matched, and will set C<$'> to the part
773of the string after the match. An example:
774
775 $x = "the cat caught the mouse";
776 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
777 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
778
779In the second match, S<C<$` = ''> > because the regexp matched at the
780first character position in the string and stopped, it never saw the
781second 'the'. It is important to note that using C<$`> and C<$'>
782slows down regexp matching quite a bit, and C< $& > slows it down to a
783lesser extent, because if they are used in one regexp in a program,
784they are generated for <all> regexps in the program. So if raw
785performance is a goal of your application, they should be avoided.
786If you need them, use C<@-> and C<@+> instead:
787
788 $` is the same as substr( $x, 0, $-[0] )
789 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
790 $' is the same as substr( $x, $+[0] )
791
792=head2 Matching repetitions
793
794The examples in the previous section display an annoying weakness. We
795were only matching 3-letter words, or syllables of 4 letters or
796less. We'd like to be able to match words or syllables of any length,
797without writing out tedious alternatives like
798C<\w\w\w\w|\w\w\w|\w\w|\w>.
799
800This is exactly the problem the B<quantifier> metacharacters C<?>,
801C<*>, C<+>, and C<{}> were created for. They allow us to determine the
802number of repeats of a portion of a regexp we consider to be a
803match. Quantifiers are put immediately after the character, character
804class, or grouping that we want to specify. They have the following
805meanings:
806
807=over 4
808
809=item *
810
811C<a?> = match 'a' 1 or 0 times
812
813=item *
814
815C<a*> = match 'a' 0 or more times, i.e., any number of times
816
817=item *
818
819C<a+> = match 'a' 1 or more times, i.e., at least once
820
821=item *
822
823C<a{n,m}> = match at least C<n> times, but not more than C<m>
824times.
825
826=item *
827
828C<a{n,}> = match at least C<n> or more times
829
830=item *
831
832C<a{n}> = match exactly C<n> times
833
834=back
835
836Here are some examples:
837
838 /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
839 # any number of digits
840 /(\w+)\s+\1/; # match doubled words of arbitrary length
841 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
842 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
843 # than 4 digits
844 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
845 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
846 # this produces $1 and the other does not.
847
848 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
849 beriberi
850 booboo
851 coco
852 mama
853 murmur
854 papa
855
856For all of these quantifiers, perl will try to match as much of the
857string as possible, while still allowing the regexp to succeed. Thus
858with C</a?.../>, perl will first try to match the regexp with the C<a>
859present; if that fails, perl will try to match the regexp without the
860C<a> present. For the quantifier C<*>, we get the following:
861
862 $x = "the cat in the hat";
863 $x =~ /^(.*)(cat)(.*)$/; # matches,
864 # $1 = 'the '
865 # $2 = 'cat'
866 # $3 = ' in the hat'
867
868Which is what we might expect, the match finds the only C<cat> in the
869string and locks onto it. Consider, however, this regexp:
870
871 $x =~ /^(.*)(at)(.*)$/; # matches,
872 # $1 = 'the cat in the h'
873 # $2 = 'at'
874 # $3 = '' (0 matches)
875
876One might initially guess that perl would find the C<at> in C<cat> and
877stop there, but that wouldn't give the longest possible string to the
878first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
879much of the string as possible while still having the regexp match. In
880this example, that means having the C<at> sequence with the final C<at>
881in the string. The other important principle illustrated here is that
882when there are two or more elements in a regexp, the I<leftmost>
883quantifier, if there is one, gets to grab as much the string as
884possible, leaving the rest of the regexp to fight over scraps. Thus in
885our example, the first quantifier C<.*> grabs most of the string, while
886the second quantifier C<.*> gets the empty string. Quantifiers that
887grab as much of the string as possible are called B<maximal match> or
888B<greedy> quantifiers.
889
890When a regexp can match a string in several different ways, we can use
891the principles above to predict which way the regexp will match:
892
893=over 4
894
895=item *
896
897Principle 0: Taken as a whole, any regexp will be matched at the
898earliest possible position in the string.
899
900=item *
901
902Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
903that allows a match for the whole regexp will be the one used.
904
905=item *
906
907Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
908C<{n,m}> will in general match as much of the string as possible while
909still allowing the whole regexp to match.
910
911=item *
912
913Principle 3: If there are two or more elements in a regexp, the
914leftmost greedy quantifier, if any, will match as much of the string
915as possible while still allowing the whole regexp to match. The next
916leftmost greedy quantifier, if any, will try to match as much of the
917string remaining available to it as possible, while still allowing the
918whole regexp to match. And so on, until all the regexp elements are
919satisfied.
920
921=back
922
923As we have seen above, Principle 0 overrides the others - the regexp
924will be matched as early as possible, with the other principles
925determining how the regexp matches at that earliest character
926position.
927
928Here is an example of these principles in action:
929
930 $x = "The programming republic of Perl";
931 $x =~ /^(.+)(e|r)(.*)$/; # matches,
932 # $1 = 'The programming republic of Pe'
933 # $2 = 'r'
934 # $3 = 'l'
935
936This regexp matches at the earliest string position, C<'T'>. One
937might think that C<e>, being leftmost in the alternation, would be
938matched, but C<r> produces the longest string in the first quantifier.
939
940 $x =~ /(m{1,2})(.*)$/; # matches,
941 # $1 = 'mm'
942 # $2 = 'ing republic of Perl'
943
944Here, The earliest possible match is at the first C<'m'> in
945C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
946a maximal C<mm>.
947
948 $x =~ /.*(m{1,2})(.*)$/; # matches,
949 # $1 = 'm'
950 # $2 = 'ing republic of Perl'
951
952Here, the regexp matches at the start of the string. The first
953quantifier C<.*> grabs as much as possible, leaving just a single
954C<'m'> for the second quantifier C<m{1,2}>.
955
956 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
957 # $1 = 'a'
958 # $2 = 'mm'
959 # $3 = 'ing republic of Perl'
960
961Here, C<.?> eats its maximal one character at the earliest possible
962position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
963the opportunity to match both C<m>'s. Finally,
964
965 "aXXXb" =~ /(X*)/; # matches with $1 = ''
966
967because it can match zero copies of C<'X'> at the beginning of the
968string. If you definitely want to match at least one C<'X'>, use
969C<X+>, not C<X*>.
970
971Sometimes greed is not good. At times, we would like quantifiers to
972match a I<minimal> piece of string, rather than a maximal piece. For
973this purpose, Larry Wall created the S<B<minimal match> > or
974B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
975the usual quantifiers with a C<?> appended to them. They have the
976following meanings:
977
978=over 4
979
980=item *
981
982C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
983
984=item *
985
986C<a*?> = match 'a' 0 or more times, i.e., any number of times,
987but as few times as possible
988
989=item *
990
991C<a+?> = match 'a' 1 or more times, i.e., at least once, but
992as few times as possible
993
994=item *
995
996C<a{n,m}?> = match at least C<n> times, not more than C<m>
997times, as few times as possible
998
999=item *
1000
1001C<a{n,}?> = match at least C<n> times, but as few times as
1002possible
1003
1004=item *
1005
1006C<a{n}?> = match exactly C<n> times. Because we match exactly
1007C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1008notational consistency.
1009
1010=back
1011
1012Let's look at the example above, but with minimal quantifiers:
1013
1014 $x = "The programming republic of Perl";
1015 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1016 # $1 = 'Th'
1017 # $2 = 'e'
1018 # $3 = ' programming republic of Perl'
1019
1020The minimal string that will allow both the start of the string C<^>
1021and the alternation to match is C<Th>, with the alternation C<e|r>
1022matching C<e>. The second quantifier C<.*> is free to gobble up the
1023rest of the string.
1024
1025 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1026 # $1 = 'm'
1027 # $2 = 'ming republic of Perl'
1028
1029The first string position that this regexp can match is at the first
1030C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1031matches just one C<'m'>. Although the second quantifier C<.*?> would
1032prefer to match no characters, it is constrained by the end-of-string
1033anchor C<$> to match the rest of the string.
1034
1035 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1036 # $1 = 'The progra'
1037 # $2 = 'm'
1038 # $3 = 'ming republic of Perl'
1039
1040In this regexp, you might expect the first minimal quantifier C<.*?>
1041to match the empty string, because it is not constrained by a C<^>
1042anchor to match the beginning of the word. Principle 0 applies here,
1043however. Because it is possible for the whole regexp to match at the
1044start of the string, it I<will> match at the start of the string. Thus
1045the first quantifier has to match everything up to the first C<m>. The
1046second minimal quantifier matches just one C<m> and the third
1047quantifier matches the rest of the string.
1048
1049 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1050 # $1 = 'a'
1051 # $2 = 'mm'
1052 # $3 = 'ing republic of Perl'
1053
1054Just as in the previous regexp, the first quantifier C<.??> can match
1055earliest at position C<'a'>, so it does. The second quantifier is
1056greedy, so it matches C<mm>, and the third matches the rest of the
1057string.
1058
1059We can modify principle 3 above to take into account non-greedy
1060quantifiers:
1061
1062=over 4
1063
1064=item *
1065
1066Principle 3: If there are two or more elements in a regexp, the
1067leftmost greedy (non-greedy) quantifier, if any, will match as much
1068(little) of the string as possible while still allowing the whole
1069regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1070any, will try to match as much (little) of the string remaining
1071available to it as possible, while still allowing the whole regexp to
1072match. And so on, until all the regexp elements are satisfied.
1073
1074=back
1075
1076Just like alternation, quantifiers are also susceptible to
1077backtracking. Here is a step-by-step analysis of the example
1078
1079 $x = "the cat in the hat";
1080 $x =~ /^(.*)(at)(.*)$/; # matches,
1081 # $1 = 'the cat in the h'
1082 # $2 = 'at'
1083 # $3 = '' (0 matches)
1084
1085=over 4
1086
1087=item 0
1088
1089Start with the first letter in the string 't'.
1090
1091=item 1
1092
1093The first quantifier '.*' starts out by matching the whole
1094string 'the cat in the hat'.
1095
1096=item 2
1097
1098'a' in the regexp element 'at' doesn't match the end of the
1099string. Backtrack one character.
1100
1101=item 3
1102
1103'a' in the regexp element 'at' still doesn't match the last
1104letter of the string 't', so backtrack one more character.
1105
1106=item 4
1107
1108Now we can match the 'a' and the 't'.
1109
1110=item 5
1111
1112Move on to the third element '.*'. Since we are at the end of
1113the string and '.*' can match 0 times, assign it the empty string.
1114
1115=item 6
1116
1117We are done!
1118
1119=back
1120
1121Most of the time, all this moving forward and backtracking happens
1122quickly and searching is fast. There are some pathological regexps,
1123however, whose execution time exponentially grows with the size of the
1124string. A typical structure that blows up in your face is of the form
1125
1126 /(a|b+)*/;
1127
1128The problem is the nested indeterminate quantifiers. There are many
1129different ways of partitioning a string of length n between the C<+>
1130and C<*>: one repetition with C<b+> of length n, two repetitions with
1131the first C<b+> length k and the second with length n-k, m repetitions
1132whose bits add up to length n, etc. In fact there are an exponential
1133number of ways to partition a string as a function of length. A
1134regexp may get lucky and match early in the process, but if there is
1135no match, perl will try I<every> possibility before giving up. So be
1136careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
1137I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
1138discussion of this and other efficiency issues.
1139
1140=head2 Building a regexp
1141
1142At this point, we have all the basic regexp concepts covered, so let's
1143give a more involved example of a regular expression. We will build a
1144regexp that matches numbers.
1145
1146The first task in building a regexp is to decide what we want to match
1147and what we want to exclude. In our case, we want to match both
1148integers and floating point numbers and we want to reject any string
1149that isn't a number.
1150
1151The next task is to break the problem down into smaller problems that
1152are easily converted into a regexp.
1153
1154The simplest case is integers. These consist of a sequence of digits,
1155with an optional sign in front. The digits we can represent with
1156C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1157regexp is
1158
1159 /[+-]?\d+/; # matches integers
1160
1161A floating point number potentially has a sign, an integral part, a
1162decimal point, a fractional part, and an exponent. One or more of these
1163parts is optional, so we need to check out the different
1164possibilities. Floating point numbers which are in proper form include
1165123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1166front is completely optional and can be matched by C<[+-]?>. We can
1167see that if there is no exponent, floating point numbers must have a
1168decimal point, otherwise they are integers. We might be tempted to
1169model these with C<\d*\.\d*>, but this would also match just a single
1170decimal point, which is not a number. So the three cases of floating
1171point number sans exponent are
1172
1173 /[+-]?\d+\./; # 1., 321., etc.
1174 /[+-]?\.\d+/; # .1, .234, etc.
1175 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1176
1177These can be combined into a single regexp with a three-way alternation:
1178
1179 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1180
1181In this alternation, it is important to put C<'\d+\.\d+'> before
1182C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1183and ignore the fractional part of the number.
1184
1185Now consider floating point numbers with exponents. The key
1186observation here is that I<both> integers and numbers with decimal
1187points are allowed in front of an exponent. Then exponents, like the
1188overall sign, are independent of whether we are matching numbers with
1189or without decimal points, and can be 'decoupled' from the
1190mantissa. The overall form of the regexp now becomes clear:
1191
1192 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1193
1194The exponent is an C<e> or C<E>, followed by an integer. So the
1195exponent regexp is
1196
1197 /[eE][+-]?\d+/; # exponent
1198
1199Putting all the parts together, we get a regexp that matches numbers:
1200
1201 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1202
1203Long regexps like this may impress your friends, but can be hard to
1204decipher. In complex situations like this, the C<//x> modifier for a
1205match is invaluable. It allows one to put nearly arbitrary whitespace
1206and comments into a regexp without affecting their meaning. Using it,
1207we can rewrite our 'extended' regexp in the more pleasing form
1208
1209 /^
1210 [+-]? # first, match an optional sign
1211 ( # then match integers or f.p. mantissas:
1212 \d+\.\d+ # mantissa of the form a.b
1213 |\d+\. # mantissa of the form a.
1214 |\.\d+ # mantissa of the form .b
1215 |\d+ # integer of the form a
1216 )
1217 ([eE][+-]?\d+)? # finally, optionally match an exponent
1218 $/x;
1219
1220If whitespace is mostly irrelevant, how does one include space
1221characters in an extended regexp? The answer is to backslash it
1222S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
1223goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
1224a space between the sign and the mantissa/integer, and we could add
1225this to our regexp as follows:
1226
1227 /^
1228 [+-]?\ * # first, match an optional sign *and space*
1229 ( # then match integers or f.p. mantissas:
1230 \d+\.\d+ # mantissa of the form a.b
1231 |\d+\. # mantissa of the form a.
1232 |\.\d+ # mantissa of the form .b
1233 |\d+ # integer of the form a
1234 )
1235 ([eE][+-]?\d+)? # finally, optionally match an exponent
1236 $/x;
1237
1238In this form, it is easier to see a way to simplify the
1239alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1240could be factored out:
1241
1242 /^
1243 [+-]?\ * # first, match an optional sign
1244 ( # then match integers or f.p. mantissas:
1245 \d+ # start out with a ...
1246 (
1247 \.\d* # mantissa of the form a.b or a.
1248 )? # ? takes care of integers of the form a
1249 |\.\d+ # mantissa of the form .b
1250 )
1251 ([eE][+-]?\d+)? # finally, optionally match an exponent
1252 $/x;
1253
1254or written in the compact form,
1255
1256 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1257
1258This is our final regexp. To recap, we built a regexp by
1259
1260=over 4
1261
1262=item *
1263
1264specifying the task in detail,
1265
1266=item *
1267
1268breaking down the problem into smaller parts,
1269
1270=item *
1271
1272translating the small parts into regexps,
1273
1274=item *
1275
1276combining the regexps,
1277
1278=item *
1279
1280and optimizing the final combined regexp.
1281
1282=back
1283
1284These are also the typical steps involved in writing a computer
1285program. This makes perfect sense, because regular expressions are
1286essentially programs written a little computer language that specifies
1287patterns.
1288
1289=head2 Using regular expressions in Perl
1290
1291The last topic of Part 1 briefly covers how regexps are used in Perl
1292programs. Where do they fit into Perl syntax?
1293
1294We have already introduced the matching operator in its default
1295C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1296the binding operator C<=~> and its negation C<!~> to test for string
1297matches. Associated with the matching operator, we have discussed the
1298single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
1299extended C<//x> modifiers.
1300
1301There are a few more things you might want to know about matching
1302operators. First, we pointed out earlier that variables in regexps are
1303substituted before the regexp is evaluated:
1304
1305 $pattern = 'Seuss';
1306 while (<>) {
1307 print if /$pattern/;
1308 }
1309
1310This will print any lines containing the word C<Seuss>. It is not as
1311efficient as it could be, however, because perl has to re-evaluate
1312C<$pattern> each time through the loop. If C<$pattern> won't be
1313changing over the lifetime of the script, we can add the C<//o>
1314modifier, which directs perl to only perform variable substitutions
1315once:
1316
1317 #!/usr/bin/perl
1318 # Improved simple_grep
1319 $regexp = shift;
1320 while (<>) {
1321 print if /$regexp/o; # a good deal faster
1322 }
1323
1324If you change C<$pattern> after the first substitution happens, perl
1325will ignore it. If you don't want any substitutions at all, use the
1326special delimiter C<m''>:
1327
1328 @pattern = ('Seuss');
1329 while (<>) {
1330 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
1331 }
1332
1333C<m''> acts like single quotes on a regexp; all other C<m> delimiters
1334act like double quotes. If the regexp evaluates to the empty string,
1335the regexp in the I<last successful match> is used instead. So we have
1336
1337 "dog" =~ /d/; # 'd' matches
1338 "dogbert =~ //; # this matches the 'd' regexp used before
1339
1340The final two modifiers C<//g> and C<//c> concern multiple matches.
1341The modifier C<//g> stands for global matching and allows the
1342matching operator to match within a string as many times as possible.
1343In scalar context, successive invocations against a string will have
1344`C<//g> jump from match to match, keeping track of position in the
1345string as it goes along. You can get or set the position with the
1346C<pos()> function.
1347
1348The use of C<//g> is shown in the following example. Suppose we have
1349a string that consists of words separated by spaces. If we know how
1350many words there are in advance, we could extract the words using
1351groupings:
1352
1353 $x = "cat dog house"; # 3 words
1354 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1355 # $1 = 'cat'
1356 # $2 = 'dog'
1357 # $3 = 'house'
1358
1359But what if we had an indeterminate number of words? This is the sort
1360of task C<//g> was made for. To extract all words, form the simple
1361regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1362
1363 while ($x =~ /(\w+)/g) {
1364 print "Word is $1, ends at position ", pos $x, "\n";
1365 }
1366
1367prints
1368
1369 Word is cat, ends at position 3
1370 Word is dog, ends at position 7
1371 Word is house, ends at position 13
1372
1373A failed match or changing the target string resets the position. If
1374you don't want the position reset after failure to match, add the
1375C<//c>, as in C</regexp/gc>. The current position in the string is
1376associated with the string, not the regexp. This means that different
1377strings have different positions and their respective positions can be
1378set or read independently.
1379
1380In list context, C<//g> returns a list of matched groupings, or if
1381there are no groupings, a list of matches to the whole regexp. So if
1382we wanted just the words, we could use
1383
1384 @words = ($x =~ /(\w+)/g); # matches,
1385 # $word[0] = 'cat'
1386 # $word[1] = 'dog'
1387 # $word[2] = 'house'
1388
1389Closely associated with the C<//g> modifier is the C<\G> anchor. The
1390C<\G> anchor matches at the point where the previous C<//g> match left
1391off. C<\G> allows us to easily do context-sensitive matching:
1392
1393 $metric = 1; # use metric units
1394 ...
1395 $x = <FILE>; # read in measurement
1396 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1397 $weight = $1;
1398 if ($metric) { # error checking
1399 print "Units error!" unless $x =~ /\Gkg\./g;
1400 }
1401 else {
1402 print "Units error!" unless $x =~ /\Glbs\./g;
1403 }
1404 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1405
1406The combination of C<//g> and C<\G> allows us to process the string a
1407bit at a time and use arbitrary Perl logic to decide what to do next.
1408Currently, the C<\G> anchor is only fully supported when used to anchor
1409to the start of the pattern.
1410
1411C<\G> is also invaluable in processing fixed length records with
1412regexps. Suppose we have a snippet of coding region DNA, encoded as
1413base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1414codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1415we can think of the DNA snippet as a sequence of 3-letter records. The
1416naive regexp
1417
1418 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1419 $dna = "ATCGTTGAATGCAAATGACATGAC";
1420 $dna =~ /TGA/;
1421
1422doesn't work; it may match a C<TGA>, but there is no guarantee that
1423the match is aligned with codon boundaries, e.g., the substring
1424S<C<GTT GAA> > gives a match. A better solution is
1425
1426 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1427 print "Got a TGA stop codon at position ", pos $dna, "\n";
1428 }
1429
1430which prints
1431
1432 Got a TGA stop codon at position 18
1433 Got a TGA stop codon at position 23
1434
1435Position 18 is good, but position 23 is bogus. What happened?
1436
1437The answer is that our regexp works well until we get past the last
1438real match. Then the regexp will fail to match a synchronized C<TGA>
1439and start stepping ahead one character position at a time, not what we
1440want. The solution is to use C<\G> to anchor the match to the codon
1441alignment:
1442
1443 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1444 print "Got a TGA stop codon at position ", pos $dna, "\n";
1445 }
1446
1447This prints
1448
1449 Got a TGA stop codon at position 18
1450
1451which is the correct answer. This example illustrates that it is
1452important not only to match what is desired, but to reject what is not
1453desired.
1454
1455B<search and replace>
1456
1457Regular expressions also play a big role in B<search and replace>
1458operations in Perl. Search and replace is accomplished with the
1459C<s///> operator. The general form is
1460C<s/regexp/replacement/modifiers>, with everything we know about
1461regexps and modifiers applying in this case as well. The
1462C<replacement> is a Perl double quoted string that replaces in the
1463string whatever is matched with the C<regexp>. The operator C<=~> is
1464also used here to associate a string with C<s///>. If matching
1465against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
1466C<s///> returns the number of substitutions made, otherwise it returns
1467false. Here are a few examples:
1468
1469 $x = "Time to feed the cat!";
1470 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1471 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1472 $more_insistent = 1;
1473 }
1474 $y = "'quoted words'";
1475 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1476 # $y contains "quoted words"
1477
1478In the last example, the whole string was matched, but only the part
1479inside the single quotes was grouped. With the C<s///> operator, the
1480matched variables C<$1>, C<$2>, etc. are immediately available for use
1481in the replacement expression, so we use C<$1> to replace the quoted
1482string with just what was quoted. With the global modifier, C<s///g>
1483will search and replace all occurrences of the regexp in the string:
1484
1485 $x = "I batted 4 for 4";
1486 $x =~ s/4/four/; # doesn't do it all:
1487 # $x contains "I batted four for 4"
1488 $x = "I batted 4 for 4";
1489 $x =~ s/4/four/g; # does it all:
1490 # $x contains "I batted four for four"
1491
1492If you prefer 'regex' over 'regexp' in this tutorial, you could use
1493the following program to replace it:
1494
1495 % cat > simple_replace
1496 #!/usr/bin/perl
1497 $regexp = shift;
1498 $replacement = shift;
1499 while (<>) {
1500 s/$regexp/$replacement/go;
1501 print;
1502 }
1503 ^D
1504
1505 % simple_replace regexp regex perlretut.pod
1506
1507In C<simple_replace> we used the C<s///g> modifier to replace all
1508occurrences of the regexp on each line and the C<s///o> modifier to
1509compile the regexp only once. As with C<simple_grep>, both the
1510C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1511
1512A modifier available specifically to search and replace is the
1513C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1514the replacement string and the evaluated result is substituted for the
1515matched substring. C<s///e> is useful if you need to do a bit of
1516computation in the process of replacing text. This example counts
1517character frequencies in a line:
1518
1519 $x = "Bill the cat";
1520 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1521 print "frequency of '$_' is $chars{$_}\n"
1522 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1523
1524This prints
1525
1526 frequency of ' ' is 2
1527 frequency of 't' is 2
1528 frequency of 'l' is 2
1529 frequency of 'B' is 1
1530 frequency of 'c' is 1
1531 frequency of 'e' is 1
1532 frequency of 'h' is 1
1533 frequency of 'i' is 1
1534 frequency of 'a' is 1
1535
1536As with the match C<m//> operator, C<s///> can use other delimiters,
1537such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1538used C<s'''>, then the regexp and replacement are treated as single
1539quoted strings and there are no substitutions. C<s///> in list context
1540returns the same thing as in scalar context, i.e., the number of
1541matches.
1542
1543B<The split operator>
1544
1545The B<C<split> > function can also optionally use a matching operator
1546C<m//> to split a string. C<split /regexp/, string, limit> splits
1547C<string> into a list of substrings and returns that list. The regexp
1548is used to match the character sequence that the C<string> is split
1549with respect to. The C<limit>, if present, constrains splitting into
1550no more than C<limit> number of strings. For example, to split a
1551string into words, use
1552
1553 $x = "Calvin and Hobbes";
1554 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1555 # $word[1] = 'and'
1556 # $word[2] = 'Hobbes'
1557
1558If the empty regexp C<//> is used, the regexp always matches and
1559the string is split into individual characters. If the regexp has
1560groupings, then list produced contains the matched substrings from the
1561groupings as well. For instance,
1562
1563 $x = "/usr/bin/perl";
1564 @dirs = split m!/!, $x; # $dirs[0] = ''
1565 # $dirs[1] = 'usr'
1566 # $dirs[2] = 'bin'
1567 # $dirs[3] = 'perl'
1568 @parts = split m!(/)!, $x; # $parts[0] = ''
1569 # $parts[1] = '/'
1570 # $parts[2] = 'usr'
1571 # $parts[3] = '/'
1572 # $parts[4] = 'bin'
1573 # $parts[5] = '/'
1574 # $parts[6] = 'perl'
1575
1576Since the first character of $x matched the regexp, C<split> prepended
1577an empty initial element to the list.
1578
1579If you have read this far, congratulations! You now have all the basic
1580tools needed to use regular expressions to solve a wide range of text
1581processing problems. If this is your first time through the tutorial,
1582why not stop here and play around with regexps a while... S<Part 2>
1583concerns the more esoteric aspects of regular expressions and those
1584concepts certainly aren't needed right at the start.
1585
1586=head1 Part 2: Power tools
1587
1588OK, you know the basics of regexps and you want to know more. If
1589matching regular expressions is analogous to a walk in the woods, then
1590the tools discussed in Part 1 are analogous to topo maps and a
1591compass, basic tools we use all the time. Most of the tools in part 2
1592are analogous to flare guns and satellite phones. They aren't used
1593too often on a hike, but when we are stuck, they can be invaluable.
1594
1595What follows are the more advanced, less used, or sometimes esoteric
1596capabilities of perl regexps. In Part 2, we will assume you are
1597comfortable with the basics and concentrate on the new features.
1598
1599=head2 More on characters, strings, and character classes
1600
1601There are a number of escape sequences and character classes that we
1602haven't covered yet.
1603
1604There are several escape sequences that convert characters or strings
1605between upper and lower case. C<\l> and C<\u> convert the next
1606character to lower or upper case, respectively:
1607
1608 $x = "perl";
1609 $string =~ /\u$x/; # matches 'Perl' in $string
1610 $x = "M(rs?|s)\\."; # note the double backslash
1611 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1612
1613C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
1614C<\U> and C<\E>, to lower or upper case:
1615
1616 $x = "This word is in lower case:\L SHOUT\E";
1617 $x =~ /shout/; # matches
1618 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1619 $x =~ /\Ukeypunch/; # matches punch card string
1620
1621If there is no C<\E>, case is converted until the end of the
1622string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1623character of C<$word> to uppercase and the rest of the characters to
1624lowercase.
1625
1626Control characters can be escaped with C<\c>, so that a control-Z
1627character would be matched with C<\cZ>. The escape sequence
1628C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1629instance,
1630
1631 $x = "\QThat !^*&%~& cat!";
1632 $x =~ /\Q!^*&%~&\E/; # check for rough language
1633
1634It does not protect C<$> or C<@>, so that variables can still be
1635substituted.
1636
1637With the advent of 5.6.0, perl regexps can handle more than just the
1638standard ASCII character set. Perl now supports B<Unicode>, a standard
1639for encoding the character sets from many of the world's written
1640languages. Unicode does this by allowing characters to be more than
1641one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
1642are still encoded as one byte, but characters greater than C<chr(127)>
1643may be stored as two or more bytes.
1644
1645What does this mean for regexps? Well, regexp users don't need to know
1646much about perl's internal representation of strings. But they do need
1647to know 1) how to represent Unicode characters in a regexp and 2) when
1648a matching operation will treat the string to be searched as a
1649sequence of bytes (the old way) or as a sequence of Unicode characters
1650(the new way). The answer to 1) is that Unicode characters greater
1651than C<chr(127)> may be represented using the C<\x{hex}> notation,
1652with C<hex> a hexadecimal integer:
1653
1654 /\x{263a}/; # match a Unicode smiley face :)
1655
1656Unicode characters in the range of 128-255 use two hexadecimal digits
1657with braces: C<\x{ab}>. Note that this is different than C<\xab>,
1658which is just a hexadecimal byte with no Unicode significance.
1659
1660B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use
1661utf8> to use any Unicode features. This is no more the case: for
1662almost all Unicode processing, the explicit C<utf8> pragma is not
1663needed. (The only case where it matters is if your Perl script is in
1664Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
1665
1666Figuring out the hexadecimal sequence of a Unicode character you want
1667or deciphering someone else's hexadecimal Unicode regexp is about as
1668much fun as programming in machine code. So another way to specify
1669Unicode characters is to use the S<B<named character> > escape
1670sequence C<\N{name}>. C<name> is a name for the Unicode character, as
1671specified in the Unicode standard. For instance, if we wanted to
1672represent or match the astrological sign for the planet Mercury, we
1673could use
1674
1675 use charnames ":full"; # use named chars with Unicode full names
1676 $x = "abc\N{MERCURY}def";
1677 $x =~ /\N{MERCURY}/; # matches
1678
1679One can also use short names or restrict names to a certain alphabet:
1680
1681 use charnames ':full';
1682 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1683
1684 use charnames ":short";
1685 print "\N{greek:Sigma} is an upper-case sigma.\n";
1686
1687 use charnames qw(greek);
1688 print "\N{sigma} is Greek sigma\n";
1689
1690A list of full names is found in the file Names.txt in the
1691lib/perl5/5.X.X/unicore directory.
1692
1693The answer to requirement 2), as of 5.6.0, is that if a regexp
1694contains Unicode characters, the string is searched as a sequence of
1695Unicode characters. Otherwise, the string is searched as a sequence of
1696bytes. If the string is being searched as a sequence of Unicode
1697characters, but matching a single byte is required, we can use the C<\C>
1698escape sequence. C<\C> is a character class akin to C<.> except that
1699it matches I<any> byte 0-255. So
1700
1701 use charnames ":full"; # use named chars with Unicode full names
1702 $x = "a";
1703 $x =~ /\C/; # matches 'a', eats one byte
1704 $x = "";
1705 $x =~ /\C/; # doesn't match, no bytes to match
1706 $x = "\N{MERCURY}"; # two-byte Unicode character
1707 $x =~ /\C/; # matches, but dangerous!
1708
1709The last regexp matches, but is dangerous because the string
1710I<character> position is no longer synchronized to the string I<byte>
1711position. This generates the warning 'Malformed UTF-8
1712character'. The C<\C> is best used for matching the binary data in strings
1713with binary data intermixed with Unicode characters.
1714
1715Let us now discuss the rest of the character classes. Just as with
1716Unicode characters, there are named Unicode character classes
1717represented by the C<\p{name}> escape sequence. Closely associated is
1718the C<\P{name}> character class, which is the negation of the
1719C<\p{name}> class. For example, to match lower and uppercase
1720characters,
1721
1722 use charnames ":full"; # use named chars with Unicode full names
1723 $x = "BOB";
1724 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1725 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1726 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1727 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1728
1729Here is the association between some Perl named classes and the
1730traditional Unicode classes:
1731
1732 Perl class name Unicode class name or regular expression
1733
1734 IsAlpha /^[LM]/
1735 IsAlnum /^[LMN]/
1736 IsASCII $code <= 127
1737 IsCntrl /^C/
1738 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
1739 IsDigit Nd
1740 IsGraph /^([LMNPS]|Co)/
1741 IsLower Ll
1742 IsPrint /^([LMNPS]|Co|Zs)/
1743 IsPunct /^P/
1744 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
1745 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
1746 IsUpper /^L[ut]/
1747 IsWord /^[LMN]/ || $code eq "005F"
1748 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1749
1750You can also use the official Unicode class names with the C<\p> and
1751C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
1752letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1753letter, the braces can be dropped. For instance, C<\pM> is the
1754character class of Unicode 'marks', for example accent marks.
1755For the full list see L<perlunicode>.
1756
1757The Unicode has also been separated into various sets of characters
1758which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in),
1759for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>.
1760For the full list see L<perlunicode>.
1761
1762C<\X> is an abbreviation for a character class sequence that includes
1763the Unicode 'combining character sequences'. A 'combining character
1764sequence' is a base character followed by any number of combining
1765characters. An example of a combining character is an accent. Using
1766the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
1767character sequence with base character C<A> and combining character
1768S<C<COMBINING RING> >, which translates in Danish to A with the circle
1769atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
1770i.e., a non-mark followed by one or more marks.
1771
1772For the full and latest information about Unicode see the latest
1773Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
1774
1775As if all those classes weren't enough, Perl also defines POSIX style
1776character classes. These have the form C<[:name:]>, with C<name> the
1777name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1778C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1779C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1780extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1781is being used, then these classes are defined the same as their
1782corresponding perl Unicode classes: C<[:upper:]> is the same as
1783C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1784require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
1785C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
1786character classes. To negate a POSIX class, put a C<^> in front of
1787the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
1788C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
1789be used just like C<\d>, with the exception that POSIX character
1790classes can only be used inside of a character class:
1791
1792 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
1793 /^=item\s[[:digit:]]/; # match '=item',
1794 # followed by a space and a digit
1795 use charnames ":full";
1796 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1797 /^=item\s\p{IsDigit}/; # match '=item',
1798 # followed by a space and a digit
1799
1800Whew! That is all the rest of the characters and character classes.
1801
1802=head2 Compiling and saving regular expressions
1803
1804In Part 1 we discussed the C<//o> modifier, which compiles a regexp
1805just once. This suggests that a compiled regexp is some data structure
1806that can be stored once and used again and again. The regexp quote
1807C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
1808regexp and transforms the result into a form that can be assigned to a
1809variable:
1810
1811 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1812
1813Then C<$reg> can be used as a regexp:
1814
1815 $x = "fooooba";
1816 $x =~ $reg; # matches, just like /foo+bar?/
1817 $x =~ /$reg/; # same thing, alternate form
1818
1819C<$reg> can also be interpolated into a larger regexp:
1820
1821 $x =~ /(abc)?$reg/; # still matches
1822
1823As with the matching operator, the regexp quote can use different
1824delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
1825delimiters C<qr''> prevent any interpolation from taking place.
1826
1827Pre-compiled regexps are useful for creating dynamic matches that
1828don't need to be recompiled each time they are encountered. Using
1829pre-compiled regexps, C<simple_grep> program can be expanded into a
1830program that matches multiple patterns:
1831
1832 % cat > multi_grep
1833 #!/usr/bin/perl
1834 # multi_grep - match any of <number> regexps
1835 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1836
1837 $number = shift;
1838 $regexp[$_] = shift foreach (0..$number-1);
1839 @compiled = map qr/$_/, @regexp;
1840 while ($line = <>) {
1841 foreach $pattern (@compiled) {
1842 if ($line =~ /$pattern/) {
1843 print $line;
1844 last; # we matched, so move onto the next line
1845 }
1846 }
1847 }
1848 ^D
1849
1850 % multi_grep 2 last for multi_grep
1851 $regexp[$_] = shift foreach (0..$number-1);
1852 foreach $pattern (@compiled) {
1853 last;
1854
1855Storing pre-compiled regexps in an array C<@compiled> allows us to
1856simply loop through the regexps without any recompilation, thus gaining
1857flexibility without sacrificing speed.
1858
1859=head2 Embedding comments and modifiers in a regular expression
1860
1861Starting with this section, we will be discussing Perl's set of
1862B<extended patterns>. These are extensions to the traditional regular
1863expression syntax that provide powerful new tools for pattern
1864matching. We have already seen extensions in the form of the minimal
1865matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
1866rest of the extensions below have the form C<(?char...)>, where the
1867C<char> is a character that determines the type of extension.
1868
1869The first extension is an embedded comment C<(?#text)>. This embeds a
1870comment into the regular expression without affecting its meaning. The
1871comment should not have any closing parentheses in the text. An
1872example is
1873
1874 /(?# Match an integer:)[+-]?\d+/;
1875
1876This style of commenting has been largely superseded by the raw,
1877freeform commenting that is allowed with the C<//x> modifier.
1878
1879The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
1880a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
1881
1882 /(?i)yes/; # match 'yes' case insensitively
1883 /yes/i; # same thing
1884 /(?x)( # freeform version of an integer regexp
1885 [+-]? # match an optional sign
1886 \d+ # match a sequence of digits
1887 )
1888 /x;
1889
1890Embedded modifiers can have two important advantages over the usual
1891modifiers. Embedded modifiers allow a custom set of modifiers to
1892I<each> regexp pattern. This is great for matching an array of regexps
1893that must have different modifiers:
1894
1895 $pattern[0] = '(?i)doctor';
1896 $pattern[1] = 'Johnson';
1897 ...
1898 while (<>) {
1899 foreach $patt (@pattern) {
1900 print if /$patt/;
1901 }
1902 }
1903
1904The second advantage is that embedded modifiers only affect the regexp
1905inside the group the embedded modifier is contained in. So grouping
1906can be used to localize the modifier's effects:
1907
1908 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
1909
1910Embedded modifiers can also turn off any modifiers already present
1911by using, e.g., C<(?-i)>. Modifiers can also be combined into
1912a single expression, e.g., C<(?s-i)> turns on single line mode and
1913turns off case insensitivity.
1914
1915=head2 Non-capturing groupings
1916
1917We noted in Part 1 that groupings C<()> had two distinct functions: 1)
1918group regexp elements together as a single unit, and 2) extract, or
1919capture, substrings that matched the regexp in the
1920grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
1921regexp to be treated as a single unit, but don't extract substrings or
1922set matching variables C<$1>, etc. Both capturing and non-capturing
1923groupings are allowed to co-exist in the same regexp. Because there is
1924no extraction, non-capturing groupings are faster than capturing
1925groupings. Non-capturing groupings are also handy for choosing exactly
1926which parts of a regexp are to be extracted to matching variables:
1927
1928 # match a number, $1-$4 are set, but we only want $1
1929 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
1930
1931 # match a number faster , only $1 is set
1932 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
1933
1934 # match a number, get $1 = whole number, $2 = exponent
1935 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
1936
1937Non-capturing groupings are also useful for removing nuisance
1938elements gathered from a split operation:
1939
1940 $x = '12a34b5';
1941 @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
1942 @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
1943
1944Non-capturing groupings may also have embedded modifiers:
1945C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
1946case insensitively and turns off multi-line mode.
1947
1948=head2 Looking ahead and looking behind
1949
1950This section concerns the lookahead and lookbehind assertions. First,
1951a little background.
1952
1953In Perl regular expressions, most regexp elements 'eat up' a certain
1954amount of string when they match. For instance, the regexp element
1955C<[abc}]> eats up one character of the string when it matches, in the
1956sense that perl moves to the next character position in the string
1957after the match. There are some elements, however, that don't eat up
1958characters (advance the character position) if they match. The examples
1959we have seen so far are the anchors. The anchor C<^> matches the
1960beginning of the line, but doesn't eat any characters. Similarly, the
1961word boundary anchor C<\b> matches, e.g., if the character to the left
1962is a word character and the character to the right is a non-word
1963character, but it doesn't eat up any characters itself. Anchors are
1964examples of 'zero-width assertions'. Zero-width, because they consume
1965no characters, and assertions, because they test some property of the
1966string. In the context of our walk in the woods analogy to regexp
1967matching, most regexp elements move us along a trail, but anchors have
1968us stop a moment and check our surroundings. If the local environment
1969checks out, we can proceed forward. But if the local environment
1970doesn't satisfy us, we must backtrack.
1971
1972Checking the environment entails either looking ahead on the trail,
1973looking behind, or both. C<^> looks behind, to see that there are no
1974characters before. C<$> looks ahead, to see that there are no
1975characters after. C<\b> looks both ahead and behind, to see if the
1976characters on either side differ in their 'word'-ness.
1977
1978The lookahead and lookbehind assertions are generalizations of the
1979anchor concept. Lookahead and lookbehind are zero-width assertions
1980that let us specify which characters we want to test for. The
1981lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
1982assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
1983
1984 $x = "I catch the housecat 'Tom-cat' with catnip";
1985 $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
1986 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
1987 # $catwords[0] = 'catch'
1988 # $catwords[1] = 'catnip'
1989 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
1990 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
1991 # middle of $x
1992
1993Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
1994non-capturing, since these are zero-width assertions. Thus in the
1995second regexp, the substrings captured are those of the whole regexp
1996itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
1997lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
1998width, i.e., a fixed number of characters long. Thus
1999C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
2000negated versions of the lookahead and lookbehind assertions are
2001denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2002They evaluate true if the regexps do I<not> match:
2003
2004 $x = "foobar";
2005 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2006 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2007 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2008
2009The C<\C> is unsupported in lookbehind, because the already
2010treacherous definition of C<\C> would become even more so
2011when going backwards.
2012
2013=head2 Using independent subexpressions to prevent backtracking
2014
2015The last few extended patterns in this tutorial are experimental as of
20165.6.0. Play with them, use them in some code, but don't rely on them
2017just yet for production code.
2018
2019S<B<Independent subexpressions> > are regular expressions, in the
2020context of a larger regular expression, that function independently of
2021the larger regular expression. That is, they consume as much or as
2022little of the string as they wish without regard for the ability of
2023the larger regexp to match. Independent subexpressions are represented
2024by C<< (?>regexp) >>. We can illustrate their behavior by first
2025considering an ordinary regexp:
2026
2027 $x = "ab";
2028 $x =~ /a*ab/; # matches
2029
2030This obviously matches, but in the process of matching, the
2031subexpression C<a*> first grabbed the C<a>. Doing so, however,
2032wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2033eventually gave back the C<a> and matched the empty string. Here, what
2034C<a*> matched was I<dependent> on what the rest of the regexp matched.
2035
2036Contrast that with an independent subexpression:
2037
2038 $x =~ /(?>a*)ab/; # doesn't match!
2039
2040The independent subexpression C<< (?>a*) >> doesn't care about the rest
2041of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2042regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
2043is no backtracking and the independent subexpression does not give
2044up its C<a>. Thus the match of the regexp as a whole fails. A similar
2045behavior occurs with completely independent regexps:
2046
2047 $x = "ab";
2048 $x =~ /a*/g; # matches, eats an 'a'
2049 $x =~ /\Gab/g; # doesn't match, no 'a' available
2050
2051Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2052one regexp to the other. Regexps with an independent subexpression are
2053much like this, with a handoff of the string to the independent
2054subexpression, and a handoff of the string back to the enclosing
2055regexp.
2056
2057The ability of an independent subexpression to prevent backtracking
2058can be quite useful. Suppose we want to match a non-empty string
2059enclosed in parentheses up to two levels deep. Then the following
2060regexp matches:
2061
2062 $x = "abc(de(fg)h"; # unbalanced parentheses
2063 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2064
2065The regexp matches an open parenthesis, one or more copies of an
2066alternation, and a close parenthesis. The alternation is two-way, with
2067the first alternative C<[^()]+> matching a substring with no
2068parentheses and the second alternative C<\([^()]*\)> matching a
2069substring delimited by parentheses. The problem with this regexp is
2070that it is pathological: it has nested indeterminate quantifiers
2071of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
2072like this could take an exponentially long time to execute if there
2073was no match possible. To prevent the exponential blowup, we need to
2074prevent useless backtracking at some point. This can be done by
2075enclosing the inner quantifier as an independent subexpression:
2076
2077 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2078
2079Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2080by gobbling up as much of the string as possible and keeping it. Then
2081match failures fail much more quickly.
2082
2083=head2 Conditional expressions
2084
2085A S<B<conditional expression> > is a form of if-then-else statement
2086that allows one to choose which patterns are to be matched, based on
2087some condition. There are two types of conditional expression:
2088C<(?(condition)yes-regexp)> and
2089C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
2090like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
2091the C<yes-regexp> will be matched. If the C<condition> is false, the
2092C<yes-regexp> will be skipped and perl will move onto the next regexp
2093element. The second form is like an S<C<'if () {} else {}'> > statement
2094in Perl. If the C<condition> is true, the C<yes-regexp> will be
2095matched, otherwise the C<no-regexp> will be matched.
2096
2097The C<condition> can have two forms. The first form is simply an
2098integer in parentheses C<(integer)>. It is true if the corresponding
2099backreference C<\integer> matched earlier in the regexp. The second
2100form is a bare zero width assertion C<(?...)>, either a
2101lookahead, a lookbehind, or a code assertion (discussed in the next
2102section).
2103
2104The integer form of the C<condition> allows us to choose, with more
2105flexibility, what to match based on what matched earlier in the
2106regexp. This searches for words of the form C<"$x$x"> or
2107C<"$x$y$y$x">:
2108
2109 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2110 beriberi
2111 coco
2112 couscous
2113 deed
2114 ...
2115 toot
2116 toto
2117 tutu
2118
2119The lookbehind C<condition> allows, along with backreferences,
2120an earlier part of the match to influence a later part of the
2121match. For instance,
2122
2123 /[ATGC]+(?(?<=AA)G|C)$/;
2124
2125matches a DNA sequence such that it either ends in C<AAG>, or some
2126other base pair combination and C<C>. Note that the form is
2127C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2128lookahead, lookbehind or code assertions, the parentheses around the
2129conditional are not needed.
2130
2131=head2 A bit of magic: executing Perl code in a regular expression
2132
2133Normally, regexps are a part of Perl expressions.
2134S<B<Code evaluation> > expressions turn that around by allowing
2135arbitrary Perl code to be a part of a regexp. A code evaluation
2136expression is denoted C<(?{code})>, with C<code> a string of Perl
2137statements.
2138
2139Code expressions are zero-width assertions, and the value they return
2140depends on their environment. There are two possibilities: either the
2141code expression is used as a conditional in a conditional expression
2142C<(?(condition)...)>, or it is not. If the code expression is a
2143conditional, the code is evaluated and the result (i.e., the result of
2144the last statement) is used to determine truth or falsehood. If the
2145code expression is not used as a conditional, the assertion always
2146evaluates true and the result is put into the special variable
2147C<$^R>. The variable C<$^R> can then be used in code expressions later
2148in the regexp. Here are some silly examples:
2149
2150 $x = "abcdef";
2151 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2152 # prints 'Hi Mom!'
2153 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2154 # no 'Hi Mom!'
2155
2156Pay careful attention to the next example:
2157
2158 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2159 # no 'Hi Mom!'
2160 # but why not?
2161
2162At first glance, you'd think that it shouldn't print, because obviously
2163the C<ddd> isn't going to match the target string. But look at this
2164example:
2165
2166 $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
2167 # but _does_ print
2168
2169Hmm. What happened here? If you've been following along, you know that
2170the above pattern should be effectively the same as the last one --
2171enclosing the d in a character class isn't going to change what it
2172matches. So why does the first not print while the second one does?
2173
2174The answer lies in the optimizations the REx engine makes. In the first
2175case, all the engine sees are plain old characters (aside from the
2176C<?{}> construct). It's smart enough to realize that the string 'ddd'
2177doesn't occur in our target string before actually running the pattern
2178through. But in the second case, we've tricked it into thinking that our
2179pattern is more complicated than it is. It takes a look, sees our
2180character class, and decides that it will have to actually run the
2181pattern to determine whether or not it matches, and in the process of
2182running it hits the print statement before it discovers that we don't
2183have a match.
2184
2185To take a closer look at how the engine does optimizations, see the
2186section L<"Pragmas and debugging"> below.
2187
2188More fun with C<?{}>:
2189
2190 $x =~ /(?{print "Hi Mom!";})/; # matches,
2191 # prints 'Hi Mom!'
2192 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2193 # prints '1'
2194 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2195 # prints '1'
2196
2197The bit of magic mentioned in the section title occurs when the regexp
2198backtracks in the process of searching for a match. If the regexp
2199backtracks over a code expression and if the variables used within are
2200localized using C<local>, the changes in the variables produced by the
2201code expression are undone! Thus, if we wanted to count how many times
2202a character got matched inside a group, we could use, e.g.,
2203
2204 $x = "aaaa";
2205 $count = 0; # initialize 'a' count
2206 $c = "bob"; # test if $c gets clobbered
2207 $x =~ /(?{local $c = 0;}) # initialize count
2208 ( a # match 'a'
2209 (?{local $c = $c + 1;}) # increment count
2210 )* # do this any number of times,
2211 aa # but match 'aa' at the end
2212 (?{$count = $c;}) # copy local $c var into $count
2213 /x;
2214 print "'a' count is $count, \$c variable is '$c'\n";
2215
2216This prints
2217
2218 'a' count is 2, $c variable is 'bob'
2219
2220If we replace the S<C< (?{local $c = $c + 1;})> > with
2221S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
2222during backtracking, and we get
2223
2224 'a' count is 4, $c variable is 'bob'
2225
2226Note that only localized variable changes are undone. Other side
2227effects of code expression execution are permanent. Thus
2228
2229 $x = "aaaa";
2230 $x =~ /(a(?{print "Yow\n";}))*aa/;
2231
2232produces
2233
2234 Yow
2235 Yow
2236 Yow
2237 Yow
2238
2239The result C<$^R> is automatically localized, so that it will behave
2240properly in the presence of backtracking.
2241
2242This example uses a code expression in a conditional to match the
2243article 'the' in either English or German:
2244
2245 $lang = 'DE'; # use German
2246 ...
2247 $text = "das";
2248 print "matched\n"
2249 if $text =~ /(?(?{
2250 $lang eq 'EN'; # is the language English?
2251 })
2252 the | # if so, then match 'the'
2253 (die|das|der) # else, match 'die|das|der'
2254 )
2255 /xi;
2256
2257Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2258C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2259code expression, we don't need the extra parentheses around the
2260conditional.
2261
2262If you try to use code expressions with interpolating variables, perl
2263may surprise you:
2264
2265 $bar = 5;
2266 $pat = '(?{ 1 })';
2267 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2268 /foo(?{ 1 })$bar/; # compile error!
2269 /foo${pat}bar/; # compile error!
2270
2271 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2272 /foo${pat}bar/; # compiles ok
2273
2274If a regexp has (1) code expressions and interpolating variables, or
2275(2) a variable that interpolates a code expression, perl treats the
2276regexp as an error. If the code expression is precompiled into a
2277variable, however, interpolating is ok. The question is, why is this
2278an error?
2279
2280The reason is that variable interpolation and code expressions
2281together pose a security risk. The combination is dangerous because
2282many programmers who write search engines often take user input and
2283plug it directly into a regexp:
2284
2285 $regexp = <>; # read user-supplied regexp
2286 $chomp $regexp; # get rid of possible newline
2287 $text =~ /$regexp/; # search $text for the $regexp
2288
2289If the C<$regexp> variable contains a code expression, the user could
2290then execute arbitrary Perl code. For instance, some joker could
2291search for S<C<system('rm -rf *');> > to erase your files. In this
2292sense, the combination of interpolation and code expressions B<taints>
2293your regexp. So by default, using both interpolation and code
2294expressions in the same regexp is not allowed. If you're not
2295concerned about malicious users, it is possible to bypass this
2296security check by invoking S<C<use re 'eval'> >:
2297
2298 use re 'eval'; # throw caution out the door
2299 $bar = 5;
2300 $pat = '(?{ 1 })';
2301 /foo(?{ 1 })$bar/; # compiles ok
2302 /foo${pat}bar/; # compiles ok
2303
2304Another form of code expression is the S<B<pattern code expression> >.
2305The pattern code expression is like a regular code expression, except
2306that the result of the code evaluation is treated as a regular
2307expression and matched immediately. A simple example is
2308
2309 $length = 5;
2310 $char = 'a';
2311 $x = 'aaaaabb';
2312 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2313
2314
2315This final example contains both ordinary and pattern code
2316expressions. It detects if a binary string C<1101010010001...> has a
2317Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2318
2319 $s0 = 0; $s1 = 1; # initial conditions
2320 $x = "1101010010001000001";
2321 print "It is a Fibonacci sequence\n"
2322 if $x =~ /^1 # match an initial '1'
2323 (
2324 (??{'0' x $s0}) # match $s0 of '0'
2325 1 # and then a '1'
2326 (?{
2327 $largest = $s0; # largest seq so far
2328 $s2 = $s1 + $s0; # compute next term
2329 $s0 = $s1; # in Fibonacci sequence
2330 $s1 = $s2;
2331 })
2332 )+ # repeat as needed
2333 $ # that is all there is
2334 /x;
2335 print "Largest sequence matched was $largest\n";
2336
2337This prints
2338
2339 It is a Fibonacci sequence
2340 Largest sequence matched was 5
2341
2342Ha! Try that with your garden variety regexp package...
2343
2344Note that the variables C<$s0> and C<$s1> are not substituted when the
2345regexp is compiled, as happens for ordinary variables outside a code
2346expression. Rather, the code expressions are evaluated when perl
2347encounters them during the search for a match.
2348
2349The regexp without the C<//x> modifier is
2350
2351 /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
2352
2353and is a great start on an Obfuscated Perl entry :-) When working with
2354code and conditional expressions, the extended form of regexps is
2355almost necessary in creating and debugging regexps.
2356
2357=head2 Pragmas and debugging
2358
2359Speaking of debugging, there are several pragmas available to control
2360and debug regexps in Perl. We have already encountered one pragma in
2361the previous section, S<C<use re 'eval';> >, that allows variable
2362interpolation and code expressions to coexist in a regexp. The other
2363pragmas are
2364
2365 use re 'taint';
2366 $tainted = <>;
2367 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2368
2369The C<taint> pragma causes any substrings from a match with a tainted
2370variable to be tainted as well. This is not normally the case, as
2371regexps are often used to extract the safe bits from a tainted
2372variable. Use C<taint> when you are not extracting safe bits, but are
2373performing some other processing. Both C<taint> and C<eval> pragmas
2374are lexically scoped, which means they are in effect only until
2375the end of the block enclosing the pragmas.
2376
2377 use re 'debug';
2378 /^(.*)$/s; # output debugging info
2379
2380 use re 'debugcolor';
2381 /^(.*)$/s; # output debugging info in living color
2382
2383The global C<debug> and C<debugcolor> pragmas allow one to get
2384detailed debugging info about regexp compilation and
2385execution. C<debugcolor> is the same as debug, except the debugging
2386information is displayed in color on terminals that can display
2387termcap color sequences. Here is example output:
2388
2389 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2390 Compiling REx `a*b+c'
2391 size 9 first at 1
2392 1: STAR(4)
2393 2: EXACT <a>(0)
2394 4: PLUS(7)
2395 5: EXACT <b>(0)
2396 7: EXACT <c>(9)
2397 9: END(0)
2398 floating `bc' at 0..2147483647 (checking floating) minlen 2
2399 Guessing start of match, REx `a*b+c' against `abc'...
2400 Found floating substr `bc' at offset 1...
2401 Guessed: match at offset 0
2402 Matching REx `a*b+c' against `abc'
2403 Setting an EVAL scope, savestack=3
2404 0 <> <abc> | 1: STAR
2405 EXACT <a> can match 1 times out of 32767...
2406 Setting an EVAL scope, savestack=3
2407 1 <a> <bc> | 4: PLUS
2408 EXACT <b> can match 1 times out of 32767...
2409 Setting an EVAL scope, savestack=3
2410 2 <ab> <c> | 7: EXACT <c>
2411 3 <abc> <> | 9: END
2412 Match successful!
2413 Freeing REx: `a*b+c'
2414
2415If you have gotten this far into the tutorial, you can probably guess
2416what the different parts of the debugging output tell you. The first
2417part
2418
2419 Compiling REx `a*b+c'
2420 size 9 first at 1
2421 1: STAR(4)
2422 2: EXACT <a>(0)
2423 4: PLUS(7)
2424 5: EXACT <b>(0)
2425 7: EXACT <c>(9)
2426 9: END(0)
2427
2428describes the compilation stage. C<STAR(4)> means that there is a
2429starred object, in this case C<'a'>, and if it matches, goto line 4,
2430i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2431optimizations performed before a match:
2432
2433 floating `bc' at 0..2147483647 (checking floating) minlen 2
2434 Guessing start of match, REx `a*b+c' against `abc'...
2435 Found floating substr `bc' at offset 1...
2436 Guessed: match at offset 0
2437
2438Then the match is executed and the remaining lines describe the
2439process:
2440
2441 Matching REx `a*b+c' against `abc'
2442 Setting an EVAL scope, savestack=3
2443 0 <> <abc> | 1: STAR
2444 EXACT <a> can match 1 times out of 32767...
2445 Setting an EVAL scope, savestack=3
2446 1 <a> <bc> | 4: PLUS
2447 EXACT <b> can match 1 times out of 32767...
2448 Setting an EVAL scope, savestack=3
2449 2 <ab> <c> | 7: EXACT <c>
2450 3 <abc> <> | 9: END
2451 Match successful!
2452 Freeing REx: `a*b+c'
2453
2454Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
2455part of the string matched and C<< <y> >> the part not yet
2456matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
2457n the compilation list above. See
2458L<perldebguts/"Debugging regular expressions"> for much more detail.
2459
2460An alternative method of debugging regexps is to embed C<print>
2461statements within the regexp. This provides a blow-by-blow account of
2462the backtracking in an alternation:
2463
2464 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2465 t(?{print "t1\n";})
2466 h(?{print "h1\n";})
2467 i(?{print "i1\n";})
2468 s(?{print "s1\n";})
2469 |
2470 t(?{print "t2\n";})
2471 h(?{print "h2\n";})
2472 a(?{print "a2\n";})
2473 t(?{print "t2\n";})
2474 (?{print "Done at position ", pos, "\n";})
2475 @x;
2476
2477prints
2478
2479 Start at position 0
2480 t1
2481 h1
2482 t2
2483 h2
2484 a2
2485 t2
2486 Done at position 4
2487
2488=head1 BUGS
2489
2490Code expressions, conditional expressions, and independent expressions
2491are B<experimental>. Don't use them in production code. Yet.
2492
2493=head1 SEE ALSO
2494
2495This is just a tutorial. For the full story on perl regular
2496expressions, see the L<perlre> regular expressions reference page.
2497
2498For more information on the matching C<m//> and substitution C<s///>
2499operators, see L<perlop/"Regexp Quote-Like Operators">. For
2500information on the C<split> operation, see L<perlfunc/split>.
2501
2502For an excellent all-around resource on the care and feeding of
2503regular expressions, see the book I<Mastering Regular Expressions> by
2504Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2505
2506=head1 AUTHOR AND COPYRIGHT
2507
2508Copyright (c) 2000 Mark Kvale
2509All rights reserved.
2510
2511This document may be distributed under the same terms as Perl itself.
2512
2513=head2 Acknowledgments
2514
2515The inspiration for the stop codon DNA example came from the ZIP
2516code example in chapter 7 of I<Mastering Regular Expressions>.
2517
2518The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2519Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2520comments.
2521
2522=cut
2523
Note: See TracBrowser for help on using the repository browser.